|
Addgene inc
pspax2 addgene Pspax2 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pspax2 addgene/product/Addgene inc Average 98 stars, based on 1 article reviews
pspax2 addgene - by Bioz Stars,
2026-03
98/100 stars
|
Buy from Supplier |
|
Addgene inc
pspax2 addgene plasmid 12260 Pspax2 Addgene Plasmid 12260, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pspax2 addgene plasmid 12260/product/Addgene inc Average 90 stars, based on 1 article reviews
pspax2 addgene plasmid 12260 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Addgene inc
pspax2 plasmid constructs Pspax2 Plasmid Constructs, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pspax2 plasmid constructs/product/Addgene inc Average 93 stars, based on 1 article reviews
pspax2 plasmid constructs - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Addgene inc
g0345 pspax2 addgene ![]() G0345 Pspax2 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/g0345 pspax2 addgene/product/Addgene inc Average 98 stars, based on 1 article reviews
g0345 pspax2 addgene - by Bioz Stars,
2026-03
98/100 stars
|
Buy from Supplier |
|
Addgene inc
recombinant dna plvx ef1a ires puro takara 631253 pspax2 ![]() Recombinant Dna Plvx Ef1a Ires Puro Takara 631253 Pspax2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/recombinant dna plvx ef1a ires puro takara 631253 pspax2/product/Addgene inc Average 92 stars, based on 1 article reviews
recombinant dna plvx ef1a ires puro takara 631253 pspax2 - by Bioz Stars,
2026-03
92/100 stars
|
Buy from Supplier |
|
Addgene inc
pspax2 ![]() Pspax2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pspax2/product/Addgene inc Average 93 stars, based on 1 article reviews
pspax2 - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Addgene inc
envelope plasmid pspax2 encoding vsv g coat protein ![]() Envelope Plasmid Pspax2 Encoding Vsv G Coat Protein, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/envelope plasmid pspax2 encoding vsv g coat protein/product/Addgene inc Average 96 stars, based on 1 article reviews
envelope plasmid pspax2 encoding vsv g coat protein - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
Lofstrand
pspax2 helper ![]() Pspax2 Helper, supplied by Lofstrand, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pspax2 helper/product/Lofstrand Average 90 stars, based on 1 article reviews
pspax2 helper - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Addgene inc
plasmid recombinant dna reagent pspax2 d trono ![]() Plasmid Recombinant Dna Reagent Pspax2 D Trono, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plasmid recombinant dna reagent pspax2 d trono/product/Addgene inc Average 94 stars, based on 1 article reviews
plasmid recombinant dna reagent pspax2 d trono - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
|
Addgene inc
pmd2.g ![]() Pmd2.G, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pmd2.g/product/Addgene inc Average 90 stars, based on 1 article reviews
pmd2.g - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Addgene inc
pwpt gfp 12255 pspax2 12260 pmd2 g 12259 ![]() Pwpt Gfp 12255 Pspax2 12260 Pmd2 G 12259, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pwpt gfp 12255 pspax2 12260 pmd2 g 12259/product/Addgene inc Average 94 stars, based on 1 article reviews
pwpt gfp 12255 pspax2 12260 pmd2 g 12259 - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cell
Article Title: Endocrine-exocrine signaling drives obesity-associated pancreatic ductal adenocarcinoma
doi: 10.1016/j.cell.2020.03.062
Figure Lengend Snippet: KEY RESOURCES TABLE
Article Snippet: Davis (University of Wisconsin) N/A Mouse: Kras LSL-G12D : B6.129S4- Kras tm4Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:008179, RRID:IMSR_JAX:008179 Mouse: p53 KO/WT :129- Trp53 tm1Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:002080, RRID:IMSR_JAX:002080 Mouse: p53 R172H/WT : 129S-Trp53 tm2Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:008652, RRID:IMSR_JAX:008652 Mouse: Kras LA2 :129S/Sv- Kras tm3Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:008185, RRID:IMSR_JAX:008185 Mouse: C57BL/6J : C57/B6 Jackson Laboratories IMSR Cat# JAX:000664, RRID:IMSR_JAX:000664 Oligonucleotides Leptin cDNA Reverse Koch Institute Swanson Biotechnology Center TCAGCATTCAGGGCTAACATCCAACT mLepR sgRNA Forward Keck Biotechnology Center at Yale CACCGTGAAAGCCACCAGACCTCGA mLepR sgRNA Reverse Keck Biotechnology Center at Yale AAACTCGAGGTCTGGTGGCTTTCAC mLepR Target Site Forward Keck Biotechnology Center at Yale GGTTCTCAGTGCACGCATTT mLepR Target Site Reverse Keck Biotechnology Center at Yale ACAACGATTTTCCTGGCATCT Leptin cDNA Forward Koch Institute Swanson Biotechnology Center ATGTGCTGGAGACCCCTGT Recombinant DNA lentiGuide-puro Addgene Cat# 52963 lentiCas9-blast Addgene Cat# 52962 pFBAAVCAGmcsBgHpa University of Iowa Viral Vector Core Cat#
Techniques: Virus, Plasmid Preparation, Generated, Transplantation Assay, Recombinant, DNA Extraction, Lysis, Extraction, Blocking Assay, Western Blot, Enzyme-linked Immunosorbent Assay, Cell Viability Assay, Reverse Transcription, Bicinchoninic Acid Protein Assay, Picogreen Assay, Derivative Assay, Software